Detail of EST/Unigene BF521526 |
Acc. | BF521526 |
Internal Acc. | EST459002 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=7e-12; Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=1e-11; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=1e-11; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=1e-11; Protochlorophyllide reductase, chloroplastic OS=Cucumis sativus E-value=4e-11; |
Length | 314 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CACTTAGCCAAACAGTTGAATGATTTTATTGATTCATCGACTCCTACATTAAGACAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835507 |
Trichome-related Gene from Literature | N/A |