Detail of EST/Unigene BF521550 |
Acc. | BF521550 |
Internal Acc. | EST459026 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=2e-71; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=6e-58; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=3e-56; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=6e-55; Beta-1,3-galactosyltransferase 15 OS=Arabidopsis thaliana E-value=3e-14; |
Length | 497 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TGTGATGGTCGGCCATCTGAGGATGATGATGGAATGCTTGTTGATGGGTTTAGAAAGTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827853 |
Trichome-related Gene from Literature | N/A |