| Detail of EST/Unigene BF521550 |
| Acc. | BF521550 |
| Internal Acc. | EST459026 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=2e-71; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=6e-58; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=3e-56; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=6e-55; Beta-1,3-galactosyltransferase 15 OS=Arabidopsis thaliana E-value=3e-14; |
| Length | 497 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | TGTGATGGTCGGCCATCTGAGGATGATGATGGAATGCTTGTTGATGGGTTTAGAAAGTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827853 |
| Trichome-related Gene from Literature | N/A |