Detail of EST/Unigene BF632400 |
Acc. | BF632400 |
Internal Acc. | NF040B02DT1F1014 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=4e-52; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-51; Zeaxanthin epoxidase, chloroplastic OS=Solanum lycopersicum E-value=2e-49; Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=6e-49; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-47; |
Length | 391 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | ATAGAATCAATGGGCTTGTGGATGGAGTTTCTGGGTCTTGGTACATTAAGTTTGATACAT |
EST members of Unigene | BF632400 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32878.1.S1_at
|
Corresponding NCBI Gene | 836838 |
Trichome-related Gene from Literature | N/A |