| Detail of EST/Unigene BF632400 |
| Acc. | BF632400 |
| Internal Acc. | NF040B02DT1F1014 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=4e-52; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-51; Zeaxanthin epoxidase, chloroplastic OS=Solanum lycopersicum E-value=2e-49; Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=6e-49; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-47; |
| Length | 391 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (1 ESTs); |
| Sequence | ATAGAATCAATGGGCTTGTGGATGGAGTTTCTGGGTCTTGGTACATTAAGTTTGATACAT |
| EST members of Unigene | BF632400 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.32878.1.S1_at
|
| Corresponding NCBI Gene | 836838 |
| Trichome-related Gene from Literature | N/A |