| Detail of EST/Unigene BF632687 |
| Acc. | BF632687 |
| Internal Acc. | NF039A07DT1F1050 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Magnesium-transporting ATPase, P-type 1 OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) E-value=2e-15; Magnesium-transporting ATPase, P-type 1 OS=Escherichia coli (strain K12) E-value=6e-15; Magnesium-transporting ATPase, P-type 1 OS=Escherichia coli O157:H7 E-value=6e-15; Magnesium-transporting ATPase, P-type 1 OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) E-value=6e-14; Magnesium-transporting ATPase, P-type 1 OS=Salmonella typhimurium (strain 14028s / SGSC 2262) E-value=6e-14; |
| Length | 427 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (1 ESTs); |
| Sequence | GAGAGAGAACTAGTCTAGGATGAAATCTCGGTGCATCGGTACCTAGATGTCACAGGAGAA |
| EST members of Unigene | BF632687 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.3.8 3.6.3.9 |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.3 P-type ATPase superfamily P-ATPase |
| Probeset |
Mtr.36360.1.S1_at
|
| Corresponding NCBI Gene | 827984 |
| Trichome-related Gene from Literature | N/A |