| Detail of EST/Unigene BF633888 |
| Acc. | BF633888 |
| Internal Acc. | NF066A09DT1F1068 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Urease OS=Canavalia ensiformis E-value=3e-96; Urease subunit alpha OS=Cytophaga hutchinsonii (strain ATCC 33406 / NCIMB 9469) E-value=5e-88; Urease subunit alpha OS=Rhodopseudomonas palustris (strain BisA53) E-value=1e-86; Urease subunit alpha OS=Trichodesmium erythraeum (strain IMS101) E-value=1e-86; Urease subunit alpha OS=Psychromonas ingrahamii (strain 37) E-value=3e-86; |
| Length | 663 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (1 ESTs); |
| Sequence | CCAAGCCTGATGAATTACATGAAATAGTCAAGGCTGGAGCTATGGGACTGAAGCTGCATG |
| EST members of Unigene | BF633888 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00791 Atrazine degradation > K01427 urease; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01427 urease; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01427 urease |
| EC | 3.5.1.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.5522.1.S1_at
|
| Corresponding NCBI Gene | 843076 |
| Trichome-related Gene from Literature | N/A |