Detail of EST/Unigene BF634130 |
Acc. | BF634130 |
Internal Acc. | NF084F11DT1F1094 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione peroxidase 8 OS=Arabidopsis thaliana E-value=2e-61; Probable phospholipid hydroperoxide glutathione peroxidase 6, mitochondrial OS=Arabidopsis thaliana E-value=8e-58; Probable phospholipid hydroperoxide glutathione peroxidase OS=Mesembryanthemum crystallinum E-value=2e-56; Glutathione peroxidase 1 OS=Helianthus annuus E-value=2e-56; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana sylvestris E-value=6e-56; |
Length | 563 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | CCATACGGTACAAAACATGAGCACCGAACCCAGTAACAGTAAGGATCCAAAATCGGTCTA |
EST members of Unigene | BF634130 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.12 1.11.1.7 1.11.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.26625.1.S1_s_at, Mtr.32929.1.S1_at
|
Corresponding NCBI Gene | 842652 |
Trichome-related Gene from Literature | N/A |