Detail of EST/Unigene BF636161 |
Acc. | BF636161 |
Internal Acc. | NF081A07DT1F1052 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase, peroxisomal OS=Yarrowia lipolytica (strain CLIB 122 / E 150) E-value=3e-51; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=2e-47; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Rattus norvegicus E-value=5e-46; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=8e-46; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=1e-45; |
Length | 684 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | GAGGTACTAACTCAATAGAATATTATATACAAAATGGTTCAAAAAGGAAAGCAAGCCATC |
EST members of Unigene | BF636161 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5575.1.S1_at
|
Corresponding NCBI Gene | 817876 |
Trichome-related Gene from Literature | 817876 |