Detail of EST/Unigene BF636197 |
Acc. | BF636197 |
Internal Acc. | NF078D09DT1F1077 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=1e-24; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=2e-24; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=3e-24; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=1e-23; Beta-glucosidase 13 OS=Arabidopsis thaliana E-value=7e-23; |
Length | 692 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | CTAAAAACGAGAAAGAAATGTTGAAAGGAAGCATAGACTTTATTGGAATCAATTATTATA |
EST members of Unigene | BF636197 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37288.1.S1_at, Mtr.8470.1.S1_s_at
|
Corresponding NCBI Gene | 834493 |
Trichome-related Gene from Literature | N/A |