Detail of EST/Unigene BF637357 |
Acc. | BF637357 |
Internal Acc. | NF027E07PL1F1053 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Mus musculus E-value=2e-21; N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Pongo abelii E-value=5e-21; N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Homo sapiens E-value=5e-21; N-alpha-acetyltransferase 16, NatA auxiliary subunit OS=Mus musculus E-value=2e-20; N-alpha-acetyltransferase 16, NatA auxiliary subunit OS=Homo sapiens E-value=5e-20; |
Length | 575 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | ACCAATTTGATTTTCATTCATACTGCTTAAGGAAAATGACTTTGCGTTCTTATGTTGACA |
EST members of Unigene | BF637357 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.3.1.88 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33012.1.S1_at
|
Corresponding NCBI Gene | 844381 |
Trichome-related Gene from Literature | N/A |