| Detail of EST/Unigene BF637357 |
| Acc. | BF637357 |
| Internal Acc. | NF027E07PL1F1053 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Mus musculus E-value=2e-21; N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Pongo abelii E-value=5e-21; N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Homo sapiens E-value=5e-21; N-alpha-acetyltransferase 16, NatA auxiliary subunit OS=Mus musculus E-value=2e-20; N-alpha-acetyltransferase 16, NatA auxiliary subunit OS=Homo sapiens E-value=5e-20; |
| Length | 575 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | ACCAATTTGATTTTCATTCATACTGCTTAAGGAAAATGACTTTGCGTTCTTATGTTGACA |
| EST members of Unigene | BF637357 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.3.1.88 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.33012.1.S1_at
|
| Corresponding NCBI Gene | 844381 |
| Trichome-related Gene from Literature | N/A |