Detail of EST/Unigene BF637612 |
Acc. | BF637612 |
Internal Acc. | NF030E07PL1F1053 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit IV, chloroplastic OS=Spinacia oleracea E-value=5e-28; Photosystem I reaction center subunit IV B, chloroplastic OS=Arabidopsis thaliana E-value=7e-28; Photosystem I reaction center subunit IV A, chloroplastic OS=Nicotiana sylvestris E-value=1e-27; Photosystem I reaction center subunit IV B, chloroplastic OS=Nicotiana sylvestris E-value=2e-27; Photosystem I reaction center subunit IV A, chloroplastic OS=Arabidopsis thaliana E-value=4e-27; |
Length | 500 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | TTGTTGTCAGGGCAACCGATGAGGCTGCCCCGGCTGCACCTGCTGCCCCCGCTGCTCCAG |
EST members of Unigene | BF637612 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10403.1.S1_at
|
Corresponding NCBI Gene | 816545 |
Trichome-related Gene from Literature | N/A |