| Detail of EST/Unigene BF638182 |
| Acc. | BF638182 |
| Internal Acc. | NF044H04PL1F1042 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=2e-41; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-29; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=7e-29; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=1e-26; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=3e-26; |
| Length | 667 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | GTTCCTTTTCACTTCCTTCTTCTTCTCCTTCTCTCAACTTCCAACTTCTCCTCCGCCACC |
| EST members of Unigene | BF638182 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.33024.1.S1_at
|
| Corresponding NCBI Gene | 823810 |
| Trichome-related Gene from Literature | N/A |