Detail of EST/Unigene BF638182 |
Acc. | BF638182 |
Internal Acc. | NF044H04PL1F1042 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=2e-41; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-29; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=7e-29; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=1e-26; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=3e-26; |
Length | 667 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | GTTCCTTTTCACTTCCTTCTTCTTCTCCTTCTCTCAACTTCCAACTTCTCCTCCGCCACC |
EST members of Unigene | BF638182 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33024.1.S1_at
|
Corresponding NCBI Gene | 823810 |
Trichome-related Gene from Literature | N/A |