| Detail of EST/Unigene BF638334 |
| Acc. | BF638334 |
| Internal Acc. | NF054D09PL1F1076 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=1e-47; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=6e-47; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=6e-47; Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=7e-47; Glycine cleavage system H protein, mitochondrial OS=Flaveria trinervia E-value=1e-45; |
| Length | 478 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | ATGGCACTGAGGATGTGGGCTTCTTCAACTGCCAATGCTCTCAAACTCTCTTCTTCTTCC |
| EST members of Unigene | BF638334 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2885.1.S1_at
|
| Corresponding NCBI Gene | 840141 |
| Trichome-related Gene from Literature | N/A |