Detail of EST/Unigene BF638334 |
Acc. | BF638334 |
Internal Acc. | NF054D09PL1F1076 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=1e-47; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=6e-47; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=6e-47; Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=7e-47; Glycine cleavage system H protein, mitochondrial OS=Flaveria trinervia E-value=1e-45; |
Length | 478 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | ATGGCACTGAGGATGTGGGCTTCTTCAACTGCCAATGCTCTCAAACTCTCTTCTTCTTCC |
EST members of Unigene | BF638334 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2885.1.S1_at
|
Corresponding NCBI Gene | 840141 |
Trichome-related Gene from Literature | N/A |