Detail of EST/Unigene BF638931 |
Acc. | BF638931 |
Internal Acc. | NF080E06PL1F1049 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Chlamydomonas reinhardtii E-value=9e-52; Oxygen-evolving enhancer protein 1, chloroplastic OS=Volvox carteri E-value=8e-48; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=2e-39; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=1e-38; Oxygen-evolving enhancer protein 1-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-38; |
Length | 507 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | CCCGCGCGGCCCTCCAGGCCCGCCCTACCAGGCGCTGCACGGTGCAGGTGCTCAGCAGCG |
EST members of Unigene | BF638931 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33032.1.S1_at
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |