| Detail of EST/Unigene BF638931 |
| Acc. | BF638931 |
| Internal Acc. | NF080E06PL1F1049 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Chlamydomonas reinhardtii E-value=9e-52; Oxygen-evolving enhancer protein 1, chloroplastic OS=Volvox carteri E-value=8e-48; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=2e-39; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=1e-38; Oxygen-evolving enhancer protein 1-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-38; |
| Length | 507 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | CCCGCGCGGCCCTCCAGGCCCGCCCTACCAGGCGCTGCACGGTGCAGGTGCTCAGCAGCG |
| EST members of Unigene | BF638931 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.33032.1.S1_at
|
| Corresponding NCBI Gene | 836789 |
| Trichome-related Gene from Literature | N/A |