| Detail of EST/Unigene BF639401 |
| Acc. | BF639401 |
| Internal Acc. | NF029F02IN1F1016 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Flap endonuclease GEN-like 1 OS=Arabidopsis thaliana E-value=1e-55; Flap endonuclease GEN-like 1 OS=Oryza sativa subsp. japonica E-value=8e-42; Flap endonuclease GEN homolog 1 OS=Mus musculus E-value=1e-09; Flap endonuclease GEN homolog 1 OS=Homo sapiens E-value=2e-08; DNA repair protein UVH3 OS=Arabidopsis thaliana E-value=3e-08; |
| Length | 543 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT (1 ESTs); |
| Sequence | CTCTGTCTTCTCTCTTCCAAAAACGTAACCTAACAGTAACATACAAAATCTGTTCAGTGT |
| EST members of Unigene | BF639401 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K04799 flap endonuclease-1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K04799 flap endonuclease-1; Genetic Information Processing > Replication and Repair > ko03450 Non-homologous end-joining > K04799 flap endonuclease-1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10846 DNA excision repair protein ERCC-5 |
| EC | 3.-.-.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.9937.1.S1_s_at
|
| Corresponding NCBI Gene | 837373 |
| Trichome-related Gene from Literature | N/A |