Detail of EST/Unigene BF641551 |
Acc. | BF641551 |
Internal Acc. | NF067F02IN1F1026 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 97B2, chloroplastic OS=Glycine max E-value=7e-98; Cytochrome P450 97B1, chloroplastic OS=Pisum sativum E-value=2e-97; Cytochrome P450 97B3, chloroplastic OS=Arabidopsis thaliana E-value=8e-86; Protein LUTEIN DEFICIENT 5, chloroplastic OS=Arabidopsis thaliana E-value=1e-40; Carotene epsilon-monooxygenase, chloroplastic OS=Arabidopsis thaliana E-value=1e-40; |
Length | 605 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (1 ESTs); |
Sequence | GGGAGTTGATGTTGATGATCGTCAGTTGAGGGATGATTTAATGACAATGCTTATTGCTGG |
EST members of Unigene | BF641551 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.-.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.17822.1.S1_at
|
Corresponding NCBI Gene | 827177 |
Trichome-related Gene from Literature | N/A |