| Detail of EST/Unigene BF641901 |
| Acc. | BF641901 |
| Internal Acc. | NF057H07IN1F1063 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase zeta class OS=Euphorbia esula E-value=2e-51; Glutathione S-transferase Z2 OS=Arabidopsis thaliana E-value=3e-45; Glutathione S-transferase 1 OS=Dianthus caryophyllus E-value=3e-45; Glutathione S-transferase Z1 OS=Arabidopsis thaliana E-value=5e-43; Glutathione S-transferase 2 (Fragment) OS=Dianthus caryophyllus E-value=2e-40; |
| Length | 675 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT (1 ESTs); |
| Sequence | CACGAACCCACTACTCCTCCTTCCCTCCCTAGAGTTTGACAGAACAGAACGTCTGCACGG |
| EST members of Unigene | BF641901 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
| EC | 2.5.1.18 5.2.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.5659.1.S1_at
|
| Corresponding NCBI Gene | 814769 |
| Trichome-related Gene from Literature | N/A |