Detail of EST/Unigene BF642374 |
Acc. | BF642374 |
Internal Acc. | NF060D12IN1F1096 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=2e-89; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=4e-83; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-61; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-61; Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=7e-61; |
Length | 596 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (1 ESTs); |
Sequence | GCCTCAGCAGCTGTTGTTAAACAAACTCCTTTCCTTGGTCAAAGGAAGGGTGCCTGCCAA |
EST members of Unigene | BF642374 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1593.1.S1_at
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |