Detail of EST/Unigene BF644355 |
Acc. | BF644355 |
Internal Acc. | NF059C05EC1F1037 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=2e-40; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=5e-27; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=8e-27; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=4e-26; Cyanogenic beta-glucosidase (Fragment) OS=Trifolium repens E-value=5e-26; |
Length | 348 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (1 ESTs); |
Sequence | GAACAAACCAAATATGGTATTCATTGGCTGTTTCAATGTGGCCATGCTTGCTCTCTTTGT |
EST members of Unigene | BF644355 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.39689.1.S1_at
|
Corresponding NCBI Gene | 835545 |
Trichome-related Gene from Literature | N/A |