| Detail of EST/Unigene BF648417 |
| Acc. | BF648417 |
| Internal Acc. | NF047B11EC1F1092 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=1e-42; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=4e-40; Lichenase OS=Nicotiana plumbaginifolia E-value=5e-40; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GGIB50 OS=Nicotiana tabacum E-value=9e-39; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Nicotiana tabacum E-value=2e-38; |
| Length | 657 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (1 ESTs); |
| Sequence | GTTTTCATATAGTTAAAACCAACACAGCCATGTCTCTCATATTGCTGCTTATTGGAGTAT |
| EST members of Unigene | BF648417 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.5770.1.S1_at, Mtr.7638.1.S1_s_at
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |