Detail of EST/Unigene BG129670 |
Acc. | BG129670 |
Internal Acc. | EST475316 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-82; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-82; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-82; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=2e-81; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=3e-81; |
Length | 556 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SHOOT_4WEEK (1 ESTs); |
Sequence | CAGCTTCTACAATGTCTCTATCTTCCCCTTCTTTTGCCGGAAAGGCGGTAAAACTCTCAC |
EST members of Unigene | BG129670 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |