Detail of EST/Unigene BG447553 |
Acc. | BG447553 |
Internal Acc. | NF012C02ST1F1000 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase AtPK2/AtPK19 OS=Arabidopsis thaliana E-value=2e-20; Serine/threonine-protein kinase AtPK1/AtPK6 OS=Arabidopsis thaliana E-value=3e-19; Protein kinase 2 OS=Dictyostelium discoideum E-value=4e-13; RAC family serine/threonine-protein kinase homolog OS=Dictyostelium discoideum E-value=2e-12; Ribosomal protein S6 kinase alpha-6 OS=Mus musculus E-value=4e-12; |
Length | 665 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
Sequence | CGAACACATAACGAATCAGAAAAGGAAGAAGAAACCATATACAGTCTGCAATGGCTTCCT |
EST members of Unigene | BG447553 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
EC | 2.7.11.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33355.1.S1_s_at
|
Corresponding NCBI Gene | 820019 |
Trichome-related Gene from Literature | N/A |