Detail of EST/Unigene BG447918 |
Acc. | BG447918 |
Internal Acc. | NF103A01EC1F1003 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-3, chloroplastic OS=Vigna unguiculata E-value=2e-10; Ferritin, chloroplastic OS=Phaseolus vulgaris E-value=7e-10; Ferritin-2, chloroplastic OS=Glycine max E-value=2e-09; Ferritin-3, chloroplastic OS=Glycine max E-value=4e-09; Ferritin-2, chloroplastic OS=Vigna unguiculata E-value=4e-09; |
Length | 678 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (1 ESTs); |
Sequence | GTTTCATGAATATAATAATAGGTGGCTGATCGTAACAATGATCCTCAATTGGCAGACTTC |
EST members of Unigene | BG447918 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5824.1.S1_at
|
Corresponding NCBI Gene | 831720 |
Trichome-related Gene from Literature | N/A |