| Detail of EST/Unigene BG447918 |
| Acc. | BG447918 |
| Internal Acc. | NF103A01EC1F1003 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-3, chloroplastic OS=Vigna unguiculata E-value=2e-10; Ferritin, chloroplastic OS=Phaseolus vulgaris E-value=7e-10; Ferritin-2, chloroplastic OS=Glycine max E-value=2e-09; Ferritin-3, chloroplastic OS=Glycine max E-value=4e-09; Ferritin-2, chloroplastic OS=Vigna unguiculata E-value=4e-09; |
| Length | 678 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (1 ESTs); |
| Sequence | GTTTCATGAATATAATAATAGGTGGCTGATCGTAACAATGATCCTCAATTGGCAGACTTC |
| EST members of Unigene | BG447918 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.5824.1.S1_at
|
| Corresponding NCBI Gene | 831720 |
| Trichome-related Gene from Literature | N/A |