Detail of EST/Unigene BG449480 |
Acc. | BG449480 |
Internal Acc. | NF052C01IN1F1004 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Pisum sativum E-value=4e-73; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Antirrhinum majus E-value=4e-67; Probable granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Arabidopsis thaliana E-value=5e-66; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Ipomoea batatas E-value=3e-65; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Solanum tuberosum E-value=3e-63; |
Length | 665 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (1 ESTs); |
Sequence | CTGACAAGGCAATCGGGGTAGCAAAATTCAATGGCCCCCTGGCTCACAAAATAATTGCTG |
EST members of Unigene | BG449480 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12272.1.S1_at
|
Corresponding NCBI Gene | 840184 |
Trichome-related Gene from Literature | N/A |