| Detail of EST/Unigene BG450042 |
| Acc. | BG450042 |
| Internal Acc. | NF011H03DT1F1032 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 22 kDa protein, chloroplastic OS=Solanum sogarandinum E-value=3e-09; Photosystem II 22 kDa protein, chloroplastic OS=Arabidopsis thaliana E-value=4e-06; Photosystem II 22 kDa protein, chloroplastic OS=Nicotiana tabacum E-value=5e-06; Photosystem II 22 kDa protein, chloroplastic OS=Solanum lycopersicum E-value=6e-06; |
| Length | 684 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (1 ESTs); |
| Sequence | CTTAAGTCTATATAAACTCTGCATGATAGTTTTTGAAAACAATTTATAGTTTATGAAAAT |
| EST members of Unigene | BG450042 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.5862.1.S1_at
|
| Corresponding NCBI Gene | 841033 |
| Trichome-related Gene from Literature | N/A |