Detail of EST/Unigene BG450042 |
Acc. | BG450042 |
Internal Acc. | NF011H03DT1F1032 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 22 kDa protein, chloroplastic OS=Solanum sogarandinum E-value=3e-09; Photosystem II 22 kDa protein, chloroplastic OS=Arabidopsis thaliana E-value=4e-06; Photosystem II 22 kDa protein, chloroplastic OS=Nicotiana tabacum E-value=5e-06; Photosystem II 22 kDa protein, chloroplastic OS=Solanum lycopersicum E-value=6e-06; |
Length | 684 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | CTTAAGTCTATATAAACTCTGCATGATAGTTTTTGAAAACAATTTATAGTTTATGAAAAT |
EST members of Unigene | BG450042 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5862.1.S1_at
|
Corresponding NCBI Gene | 841033 |
Trichome-related Gene from Literature | N/A |