| Detail of EST/Unigene BG450735 |
| Acc. | BG450735 |
| Internal Acc. | NF111H05DT1F1046 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-40; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-40; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-39; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=4e-38; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=1e-36; |
| Length | 635 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (1 ESTs); |
| Sequence | GAGTAACCATGGCATGTTCATTAAAGAGTGTTTTCTATGTTCCTAAATTGAATGAGAGTA |
| EST members of Unigene | BG450735 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.5877.1.S1_at
|
| Corresponding NCBI Gene | 837379 |
| Trichome-related Gene from Literature | N/A |