Detail of EST/Unigene BG450735 |
Acc. | BG450735 |
Internal Acc. | NF111H05DT1F1046 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-40; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-40; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-39; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=4e-38; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=1e-36; |
Length | 635 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | GAGTAACCATGGCATGTTCATTAAAGAGTGTTTTCTATGTTCCTAAATTGAATGAGAGTA |
EST members of Unigene | BG450735 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5877.1.S1_at
|
Corresponding NCBI Gene | 837379 |
Trichome-related Gene from Literature | N/A |