Detail of EST/Unigene BG452115 |
Acc. | BG452115 |
Internal Acc. | NF083H06LF1F1060 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A thioesterase 9, mitochondrial OS=Mus musculus E-value=4e-19; Acyl-coenzyme A thioesterase 10, mitochondrial OS=Mus musculus E-value=1e-18; Acyl-coenzyme A thioesterase 9, mitochondrial OS=Homo sapiens E-value=1e-17; Acyl-coenzyme A thioesterase 9, mitochondrial OS=Bos taurus E-value=1e-16; |
Length | 675 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | AATTAAGGAAAAAAAAGAAGGAAGAACAAAAACATGGAGAGAATGCAGACAATGCCAGGC |
EST members of Unigene | BG452115 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.1.2.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10177.1.S1_at
|
Corresponding NCBI Gene | 817623 |
Trichome-related Gene from Literature | N/A |