Detail of EST/Unigene BG453341 |
Acc. | BG453341 |
Internal Acc. | NF090C01LF1F1002 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Isoflavonoid 7-O-beta-apiosyl-glucoside beta-glycosidase OS=Dalbergia nigrescens E-value=2e-42; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=8e-40; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=2e-39; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=9e-38; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=4e-37; |
Length | 650 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | CTCAATTAAGCAATGCAAATTCTAGCTACCTAACAGATTCTCTGATTAGTTTTTCATTCG |
EST members of Unigene | BG453341 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33545.1.S1_s_at
|
Corresponding NCBI Gene | 819052 |
Trichome-related Gene from Literature | N/A |