Detail of EST/Unigene BG454055 |
Acc. | BG454055 |
Internal Acc. | NF105G09LF1F1069 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=7e-34; Omega-6 fatty acid desaturase, chloroplastic OS=Brassica napus E-value=4e-32; Omega-6 fatty acid desaturase, chloroplastic OS=Spinacia oleracea E-value=4e-31; Fatty acid desaturase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=6e-30; Omega-6 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-29; |
Length | 672 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | TGAACTCGTTCCCGACATCTATGAACGAGCTGGCAGACCTATTGCCAAAAGAGGTGTTTC |
EST members of Unigene | BG454055 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5958.1.S1_at
|
Corresponding NCBI Gene | 829220 |
Trichome-related Gene from Literature | N/A |