| Detail of EST/Unigene BG454125 |
| Acc. | BG454125 |
| Internal Acc. | NF107E11LF1F1084 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Phytoene synthase, chloroplastic OS=Cucumis melo E-value=2e-20; Phytoene synthase 2, chloroplastic (Fragment) OS=Solanum lycopersicum E-value=4e-20; Phytoene synthase, chloroplastic OS=Capsicum annuum E-value=4e-19; Phytoene synthase, chloroplastic OS=Arabidopsis thaliana E-value=6e-19; Phytoene synthase, chloroplastic OS=Narcissus pseudonarcissus E-value=2e-18; |
| Length | 543 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | GTTTGGTGTAGGAGGACGGATGAACTTGTCGATGGCCCTAATGCTTCACATATTACAGCA |
| EST members of Unigene | BG454125 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.5964.1.S1_at
|
| Corresponding NCBI Gene | 831587 |
| Trichome-related Gene from Literature | N/A |