Detail of EST/Unigene BG454756 |
Acc. | BG454756 |
Internal Acc. | NF105F05LF1F1044 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase kinase 6 OS=Arabidopsis thaliana E-value=3e-97; Mitogen-activated protein kinase kinase 1 OS=Oryza sativa subsp. japonica E-value=4e-89; Mitogen-activated protein kinase kinase 1 OS=Arabidopsis thaliana E-value=5e-72; Mitogen-activated protein kinase kinase 2 OS=Arabidopsis thaliana E-value=6e-72; Dual specificity mitogen-activated protein kinase kinase 1 OS=Dictyostelium discoideum E-value=1e-45; |
Length | 648 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | GATTGTTCAGGAATTGAAAATAAACCAAGCATCACAGTGTCCACATGTTGTAGTTTGCTA |
EST members of Unigene | BG454756 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04368 mitogen-activated protein kinase kinase 1 |
EC | 2.7.12.2 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
Mtr.33596.1.S1_at
|
Corresponding NCBI Gene | 835759 |
Trichome-related Gene from Literature | N/A |