Detail of EST/Unigene BG454949 |
Acc. | BG454949 |
Internal Acc. | NF110G07LF1F1053 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 10 kDa polypeptide, chloroplastic OS=Brassica campestris E-value=6e-17; Photosystem II 10 kDa polypeptide, chloroplastic OS=Arabidopsis thaliana E-value=3e-15; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum tuberosum E-value=1e-12; Photosystem II 10 kDa polypeptide, chloroplastic OS=Nicotiana tabacum E-value=2e-12; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum lycopersicum E-value=2e-12; |
Length | 676 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | GAGAGATCGACACAACACAAACAGCGACCAGAACACTTTCTTCCTTGGCGTAACAAAGCG |
EST members of Unigene | BG454949 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5984.1.S1_at
|
Corresponding NCBI Gene | 844245 |
Trichome-related Gene from Literature | N/A |