Detail of EST/Unigene BG455191 |
Acc. | BG455191 |
Internal Acc. | NF100G03PL1F1022 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Lotus japonicus E-value=2e-24; NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Spinacia oleracea E-value=2e-23; NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Glycine max E-value=4e-23; NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Morus indica E-value=4e-23; NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Calycanthus floridus var. glaucus E-value=5e-23; |
Length | 654 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | AAATTTCCATCCAAGATTTAATAATTGATCCATTCTTAGCCTAGGCAAAGACCATCTTGT |
EST members of Unigene | BG455191 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33603.1.S1_s_at
|
Corresponding NCBI Gene | 831183 |
Trichome-related Gene from Literature | N/A |