Detail of EST/Unigene BG455209
Acc. BG455209
Internal Acc. NF102G11PL1F1086
Type Singleton/Unigene
Annotation (Top 5 hits in Uniprot_trembl) p-hydroxybenzoic acid efflux pump subunit AaeB OS=Shigella sonnei (strain Ss046) E-value=6e-14; p-hydroxybenzoic acid efflux pump subunit AaeB OS=Shigella flexneri E-value=6e-14; p-hydroxybenzoic acid efflux pump subunit AaeB OS=Shigella flexneri serotype 5b (strain 8401) E-value=6e-14; p-hydroxybenzoic acid efflux pump subunit AaeB OS=Shigella dysenteriae serotype 1 (strain Sd197) E-value=6e-14; p-hydroxybenzoic acid efflux pump subunit AaeB OS=Escherichia coli (strain UTI89 / UPEC) E-value=6e-14;
Length 118 nt
Species Medicago truncatula
Belonged EST Libraries MT_PhoLEAF (1 ESTs);
Sequence TCTACTTTTTGGTGATTATCCCTAATACCCAACAGAGCATGTTGCTGCTGTGCATTAGCC
TGGCAGTGCTGGGATTCTTCCTCGGTATAGAAGTACAGAAACGGCGACTGGGCTCGAT
EST members of Unigene BG455209 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family 2.A.8 Gluconate,H+ symporter GntP
Probeset Mtr.5987.1.S1_at
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A