| Detail of EST/Unigene BG455238 |
| Acc. | BG455238 |
| Internal Acc. | NF105E01PL1F1005 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=6e-14; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=1e-13; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=2e-13; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=2e-13; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=2e-13; |
| Length | 142 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | GAAGCCCCATCCTACCTCACCGGTGAATTTCCTGGTGACTACGGTTGGGACACTGCTGGA |
| EST members of Unigene | BG455238 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |