| Detail of EST/Unigene BG456653 |
| Acc. | BG456653 |
| Internal Acc. | NF096C09PL1F1068 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=6e-80; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-79; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-79; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=2e-79; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-79; |
| Length | 504 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | TGCTGATCCAGTTAACAACAATGCTTGGGCCTATGCCACAAACTTTGCCCCTGGAAAATA |
| EST members of Unigene | BG456653 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |