Detail of EST/Unigene BG456653 |
Acc. | BG456653 |
Internal Acc. | NF096C09PL1F1068 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=6e-80; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-79; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-79; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=2e-79; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-79; |
Length | 504 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | TGCTGATCCAGTTAACAACAATGCTTGGGCCTATGCCACAAACTTTGCCCCTGGAAAATA |
EST members of Unigene | BG456653 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |