Detail of EST/Unigene BG457096 |
Acc. | BG457096 |
Internal Acc. | NF069G01PL1F1006 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Putative branched-chain-amino-acid aminotransferase 7 OS=Arabidopsis thaliana E-value=3e-43; Branched-chain-amino-acid aminotransferase 6 OS=Arabidopsis thaliana E-value=2e-41; Branched-chain-amino-acid aminotransferase 5, chloroplastic OS=Arabidopsis thaliana E-value=5e-41; Branched-chain-amino-acid aminotransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-38; Branched-chain-amino-acid aminotransferase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-38; |
Length | 538 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | CTTCTCTTTTCCTAGATCTTTATTTCTCTTCTCTTTCCTACAACAACCTTCATTCAAAGT |
EST members of Unigene | BG457096 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00290 Valine, leucine and isoleucine biosynthesis > K00826 branched-chain amino acid aminotransferase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00826 branched-chain amino acid aminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K00826 branched-chain amino acid aminotransferase |
EC | 2.6.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6007.1.S1_at
|
Corresponding NCBI Gene | 841432 |
Trichome-related Gene from Literature | N/A |