| Detail of EST/Unigene BG457327 |
| Acc. | BG457327 |
| Internal Acc. | NF101G09PL1F1070 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ornithine decarboxylase, constitutive OS=Escherichia coli (strain K12) E-value=1e-17; Ornithine decarboxylase, inducible OS=Escherichia coli (strain K12) E-value=6e-16; Ornithine decarboxylase OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) E-value=6e-16; Ornithine decarboxylase, inducible OS=Lactobacillus sp. (strain 30a) E-value=2e-13; |
| Length | 121 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | CGCCCGTATCGCCTGGCGATTATTCAGCTGGGAACCTATGACGGCACTGTCTATAACGCC |
| EST members of Unigene | BG457327 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.33631.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |