Detail of EST/Unigene BG457327 |
Acc. | BG457327 |
Internal Acc. | NF101G09PL1F1070 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ornithine decarboxylase, constitutive OS=Escherichia coli (strain K12) E-value=1e-17; Ornithine decarboxylase, inducible OS=Escherichia coli (strain K12) E-value=6e-16; Ornithine decarboxylase OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) E-value=6e-16; Ornithine decarboxylase, inducible OS=Lactobacillus sp. (strain 30a) E-value=2e-13; |
Length | 121 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | CGCCCGTATCGCCTGGCGATTATTCAGCTGGGAACCTATGACGGCACTGTCTATAACGCC |
EST members of Unigene | BG457327 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33631.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |