Detail of EST/Unigene BG457482 |
Acc. | BG457482 |
Internal Acc. | NF104B07PL1F1059 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=2e-38; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=3e-23; Chlorophyll a-b binding protein 5, chloroplastic (Fragment) OS=Solanum lycopersicum E-value=5e-23; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=5e-23; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=5e-23; |
Length | 563 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | AATTCATCAAAGCTTAGTTTGAGTTGAAGATTCCTAAAACCAACCATGGCTTCCATTGCT |
EST members of Unigene | BG457482 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37311.1.S1_at
|
Corresponding NCBI Gene | 826626 |
Trichome-related Gene from Literature | N/A |