Detail of EST/Unigene BG457534
Acc. BG457534
Internal Acc. NF104H06PL1F1058
Type Singleton/Unigene
Annotation (Top 5 hits in Uniprot_trembl) PTS system N-acetylglucosamine-specific EIICBA component OS=Escherichia coli (strain K12) E-value=1e-27; PTS system N-acetylglucosamine-specific EIICBA component OS=Klebsiella pneumoniae E-value=3e-26; PTS system glucose-specific EIICB component OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) E-value=2e-10; PTS system glucose-specific EIICB component OS=Escherichia coli (strain K12) E-value=1e-09; PTS system glucose-specific EIICB component OS=Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC) E-value=1e-09;
Length 173 nt
Species Medicago truncatula
Belonged EST Libraries MT_PhoLEAF (1 ESTs);
Sequence AATTCACCAACGCGGCGGGTACGGTTTTCCACGGTGACATTAACCGCTTCTATGCCGGTG
ACGGCACCGCGGGGATGTTCATGTCCGGCTTCTTCCCGATCATGATGTTCGGTCTGCCGG
GTGCGGCGCTGGCGATGTACTTCGCAGCACCGAAAGAGCGTCGTCCGATGGTT
EST members of Unigene BG457534 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family 4.A.1 PTS Glucose-glucoside Glc
Probeset Mtr.33636.1.S1_at
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A