Detail of EST/Unigene BG580525 |
Acc. | BG580525 |
Internal Acc. | EST482250 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-isopropylmalate dehydrogenase, chloroplastic OS=Brassica napus E-value=3e-28; 3-isopropylmalate dehydrogenase 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-28; 3-isopropylmalate dehydrogenase 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-28; 3-isopropylmalate dehydrogenase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-27; 3-isopropylmalate dehydrogenase OS=Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1) E-value=5e-20; |
Length | 561 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | GAACCTATACATGGTTCTGCACCCGATATTGCTGGACAGGACAAAGCAAACCCATTTGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.1.1.41 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844395 |
Trichome-related Gene from Literature | N/A |