| Detail of EST/Unigene BG580532 |
| Acc. | BG580532 |
| Internal Acc. | EST482259 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protease Do-like 9 OS=Arabidopsis thaliana E-value=2e-20; Protease Do-like 10, mitochondrial OS=Arabidopsis thaliana E-value=8e-10; Protease Do-like 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-09; Putative protease Do-like 3, mitochondrial OS=Arabidopsis thaliana E-value=6e-08; Protease Do-like 4, mitochondrial OS=Arabidopsis thaliana E-value=5e-07; |
| Length | 630 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | TGCTCTTCCCTTAACCCTGTCCGTTTCTTTCTCAGCAGATGAACCATTTCATACAAACTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834018 |
| Trichome-related Gene from Literature | N/A |