Detail of EST/Unigene BG580969 |
Acc. | BG580969 |
Internal Acc. | EST482698 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Guanine nucleotide-binding protein subunit beta-like protein OS=Medicago sativa E-value=0; Guanine nucleotide-binding protein subunit beta-like protein OS=Glycine max E-value=0; Guanine nucleotide-binding protein subunit beta-like protein A OS=Arabidopsis thaliana E-value=6e-93; Guanine nucleotide-binding protein subunit beta-like protein B OS=Arabidopsis thaliana E-value=1e-92; Guanine nucleotide-binding protein subunit beta-like protein C OS=Arabidopsis thaliana E-value=1e-92; |
Length | 624 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | AACCTTAGCTGAAACTGCCACTCAATTCCACAGAAACCACCAATCATGGCTGAGGGTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03362 F-box and WD-40 domain protein 1/11 |
EC | 2.1.1.63 |
Transcription Factor Family | C3H |
Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
Probeset |
|
Corresponding NCBI Gene | 838388 |
Trichome-related Gene from Literature | N/A |