Detail of EST/Unigene BG581327 |
Acc. | BG581327 |
Internal Acc. | EST483060 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A oxidase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; Acyl-coenzyme A oxidase, peroxisomal OS=Cucurbita maxima E-value=0; Peroxisomal acyl-coenzyme A oxidase 1 OS=Phascolarctos cinereus E-value=4e-28; Peroxisomal acyl-coenzyme A oxidase 1 OS=Pongo abelii E-value=9e-28; Peroxisomal acyl-coenzyme A oxidase 1 OS=Homo sapiens E-value=9e-28; |
Length | 811 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | TAGGCCTTGCATATTCTTCTGTAAGCGTCCTCAAGTGTCGGCCACTATTGCCATCAGATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
EC | 1.3.3.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836635 |
Trichome-related Gene from Literature | N/A |