| Detail of EST/Unigene BG581635 |
| Acc. | BG581635 |
| Internal Acc. | EST483370 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mannan endo-1,4-beta-mannosidase 2 OS=Arabidopsis thaliana E-value=6e-30; Mannan endo-1,4-beta-mannosidase 5 OS=Arabidopsis thaliana E-value=2e-24; Mannan endo-1,4-beta-mannosidase 2 OS=Oryza sativa subsp. japonica E-value=1e-19; Putative mannan endo-1,4-beta-mannosidase 4 OS=Arabidopsis thaliana E-value=2e-13; Putative mannan endo-1,4-beta-mannosidase P OS=Arabidopsis thaliana E-value=9e-13; |
| Length | 809 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | GTTTTAGTTTCTTCTAACTCATAATCTCCGCTAATTTTGTCTATTTTTGAGGATAATTAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816596 |
| Trichome-related Gene from Literature | N/A |