Detail of EST/Unigene BG581832 |
Acc. | BG581832 |
Internal Acc. | EST483568 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Estradiol 17-beta-dehydrogenase 12 OS=Rattus norvegicus E-value=4e-27; Estradiol 17-beta-dehydrogenase 12 OS=Mus musculus E-value=4e-26; Estradiol 17-beta-dehydrogenase 12 OS=Macaca fascicularis E-value=9e-26; 3-ketoacyl-CoA reductase OS=Magnaporthe oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) E-value=2e-24; Estradiol 17-beta-dehydrogenase 12 OS=Homo sapiens E-value=2e-24; |
Length | 708 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | TTCTGCTCATCTACCTTACCAGTACTACGATACCATTCCCACACTACTCTCCCTTCATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
EC | 1.1.1.- 1.1.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843098 |
Trichome-related Gene from Literature | N/A |