| Detail of EST/Unigene BG582076 |
| Acc. | BG582076 |
| Internal Acc. | EST483814 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Heat shock 22 kDa protein, mitochondrial OS=Pisum sativum E-value=4e-59; 23.6 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=6e-44; Heat shock 22 kDa protein, mitochondrial OS=Glycine max E-value=2e-38; 23.5 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=4e-35; Small heat shock protein, chloroplastic OS=Chenopodium rubrum E-value=5e-33; |
| Length | 824 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | ATCGTGAATCGTTTCCTTCCATCTCTCAAATGGCTTCTTCTGTTGCAGTCAAGCGAATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828623 |
| Trichome-related Gene from Literature | N/A |