Detail of EST/Unigene BG582275 |
Acc. | BG582275 |
Internal Acc. | EST484015 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-20; Replication protein A 32 kDa subunit OS=Rattus norvegicus E-value=1e-17; Replication protein A 32 kDa subunit OS=Homo sapiens E-value=6e-17; Replication protein A 32 kDa subunit OS=Pongo abelii E-value=7e-17; Replication protein A 32 kDa subunit OS=Mus musculus E-value=1e-15; |
Length | 772 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | GGTTTCACGATGTTCTCCAATTCCCAATTCGATTCCTCCAACGCCTTCTCCGGCGGCGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10739 replication factor A2 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816985 |
Trichome-related Gene from Literature | N/A |