Detail of EST/Unigene BG582305 |
Acc. | BG582305 |
Internal Acc. | EST484047 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=0; Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=2e-96; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=9e-90; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=3e-79; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=7e-68; |
Length | 679 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | AAACAGCACTGAGGGAGGTTATTGAAAAGTATAATTTGAATGTTAGGTTAACTCCAAATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830336 |
Trichome-related Gene from Literature | 830336 |