| Detail of EST/Unigene BG582386 |
| Acc. | BG582386 |
| Internal Acc. | EST484129 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Histidine decarboxylase OS=Solanum lycopersicum E-value=6e-78; Histidine decarboxylase OS=Pseudomonas entomophila (strain L48) E-value=1e-48; Histidine decarboxylase OS=Morganella morganii E-value=8e-48; Histidine decarboxylase OS=Pseudomonas fluorescens E-value=1e-47; Histidine decarboxylase OS=Raoultella planticola E-value=2e-45; |
| Length | 778 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | GAAACTGTGGCACAGAAGGCAATCTCCCGGCATCTTAGTTGGGAGAGAGGTATTACCAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01580 glutamate decarboxylase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01580 glutamate decarboxylase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01580 glutamate decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01580 glutamate decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K01580 glutamate decarboxylase |
| EC | 4.1.1.15 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840958 |
| Trichome-related Gene from Literature | N/A |