| Detail of EST/Unigene BG583097 |
| Acc. | BG583097 |
| Internal Acc. | EST484847 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Frataxin, mitochondrial OS=Arabidopsis thaliana E-value=3e-36; Frataxin, mitochondrial OS=Mus musculus E-value=2e-17; Frataxin homolog, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-16; Frataxin, mitochondrial OS=Homo sapiens E-value=4e-16; Frataxin, mitochondrial OS=Bos taurus E-value=6e-16; |
| Length | 841 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | CGAGGCACGATCACGACCCCACAGTCACAAAGCATTCAGCTTTGTTTTCTGTCATCATCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828013 |
| Trichome-related Gene from Literature | N/A |