Detail of EST/Unigene BG583097 |
Acc. | BG583097 |
Internal Acc. | EST484847 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Frataxin, mitochondrial OS=Arabidopsis thaliana E-value=3e-36; Frataxin, mitochondrial OS=Mus musculus E-value=2e-17; Frataxin homolog, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-16; Frataxin, mitochondrial OS=Homo sapiens E-value=4e-16; Frataxin, mitochondrial OS=Bos taurus E-value=6e-16; |
Length | 841 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | CGAGGCACGATCACGACCCCACAGTCACAAAGCATTCAGCTTTGTTTTCTGTCATCATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828013 |
Trichome-related Gene from Literature | N/A |